Elicit: TDP-43 Biological Pathways (Public)

Skip to main content

TDP-43 Biological Pathways (Public)

Research reportView only

Create alertChat

March 2, 2025

What biological pathways is TDP-43 known to be part of?

TDP-43 functions in seven major biological pathways: RNA metabolism, nucleocytoplasmic transport, stress response, mitochondrial function, synaptic function, inflammatory responses, and cell cycle regulation.

Abstract

Forty studies report that TDP-43 participates in a network of biological pathways. In several papers, TDP-43 regulates RNA metabolism by controlling alternative splicing, cryptic exon inclusion, and mRNA stability. Other studies document that TDP-43 affects nucleocytoplasmic transport by disrupting nuclear pore complex integrity and altering protein–RNA distribution. Reports also describe its role in stress response and protein quality control through modulation of stress granule dynamics, phase separation, and aggresome formation. In addition, TDP-43 has been linked to mitochondrial function via binding mitochondrial mRNAs and disrupting respiratory complex assembly, as well as to synaptic function and neurotransmitter regulation through effects on receptor recycling and synaptic protein expression. Some papers further implicate the protein in inflammatory and immune responses via activation of NF‑κB and inflammasome pathways, and in cell cycle regulation and DNA repair by modulating targets such as cyclin-dependent kinase expression and double-strand break repair.

Seven primary pathways emerge from these studies: 1. RNA metabolism and processing 2. Nucleocytoplasmic transport 3. Stress response and protein quality control 4. Mitochondrial function 5. Synaptic function and neurotransmitter regulation 6. Inflammatory and immune responses 7. Cell cycle regulation and DNA repair

Diverse experimental systems—including mouse models, cultured cells, and iPSC-derived neurons—support TDP-43’s multifaceted functions across these interrelated pathways.

Methods

We analyzed 40 sources from an initial pool of 493, using 6 screening criteria. Each paper was reviewed for 3 key aspects that mattered most to the research question. More on methods

Papers identified with Elicit search

n = 493

Papers screened using: Molecular Pathway Analysis, TDP-43 Function, Experimental Design, Study Type, Mechanistic Detail, Evidence Quality

n = 493

Papers screened out

n = 453

Papers included for extraction

n = 40

Press enter or space to select a node.You can then use the arrow keys to move the node around. Press delete to remove it and escape to cancel.

Press enter or space to select an edge. You can then press delete to remove it or escape to cancel.

Paper search

Using your research question “What biological pathways is TDP-43 known to be part of?”, we searched across over 126 million academic papers from the Semantic Scholar corpus. We retrieved the 493 papers most relevant to the query.

Screening

We screened in sources based on their abstracts that met these criteria:

We considered all screening questions together and made a holistic judgement about whether to screen in each paper.

Data extraction

We asked a large language model to extract each data column below from each paper. We gave the model the extraction instructions shown below for each column.

Extract all explicitly mentioned biological pathways or cellular processes that TDP-43 is involved in. Look in the methods, results, and discussion sections.

Specific areas to focus on:

If multiple pathways are mentioned, list them all. If a pathway is described but not explicitly named, summarize the description.

If no clear pathways are identified, write “No specific pathways explicitly described.”

Format examples:

Identify and list all molecular interactions and binding partners mentioned in the study.

Search in:

Extract:

If multiple interactions are found, list all. If no interactions are described, write “No molecular interactions reported.”

Format examples:

Extract specific functional outcomes or consequences resulting from TDP-43 interactions or modifications.

Look for:

Prioritize direct functional descriptions, not just descriptive observations.

If multiple consequences are found, list all. If no clear functional outcomes are described, write “No specific functional consequences reported.”

Format examples:

Results

Characteristics of Included Studies

Study

Study Design

Cellular/Model System

Pathways Investigated

Key Findings

Full text retrieved

“TDP‐43 Loss of Function,” 2016

In vitro study

Neuronal cell culture

Endosomal trafficking

The study reported that TDP-43 regulates endosomal trafficking and receptor recycling

No

Afroz et al., 2023

In vivo mouse model and in vitro studies

Mouse models, Amyotrophic Lateral Sclerosis (ALS) patient-derived microglia

Immune response, phagocytosis

The study reported that targeting TDP-43 C-terminal domain reduces pathology and enhances microglial function

No

Ayala et al., 2008

In vitro study

Human cells

Cell cycle regulation

The study reported that TDP-43 regulates Cyclin-dependent kinase 6 (Cdk6) expression and cell cycle progression

Yes

Chen, 2020

Review

Various

RNA metabolism, autophagy

The review reported that TDP-43 regulates cryptic exon splicing and autophagy pathways

No

Chou et al., 2017

In vitro and in vivo studies

Mouse primary neurons, human fibroblasts, induced pluripotent stem cell (iPSC)-derived neurons

Nucleocytoplasmic transport

The study reported that TDP-43 aggregates disrupt nuclear pore complexes and nucleocytoplasmic transport

Yes

Chou et al., 2018

In vitro and in vivo studies

Mouse primary neurons, human fibroblasts, iPSC-derived neurons

Nucleocytoplasmic transport

The study reported that TDP-43 pathology impairs nuclear protein import and RNA export

Yes

Deshaies et al., 2018

In vitro and in vivo studies

Human cells, mouse models

RNA splicing

The study reported that TDP-43 regulates alternative splicing of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1)

Yes

Fazal et al., 2021

iPSC-derived motor neuron study

Human iPSC-derived motor neurons

RNA metabolism, axonal transport

The study reported that TDP-43 mutations affect RNA processing and axonal transport

Yes

Feneberg et al., 2020

In vitro and in vivo studies

Mouse primary motor neurons

Protein-protein interactions, stress response

The study reported that TDP-43 interacts with proteins involved in stress granule formation and endosomal-extracellular transport

No

Feneberga et al., “Oxidative Stress in Motor Neurons”

In vitro and in vivo studies

Mouse primary motor neurons

Protein-protein interactions, stress response

The study reported that TDP-43 mutations affect stress granule formation and extracellular vesicle secretion

No

toof

Pageof

View 30 more rows

Our analysis of the 40 studies on TDP-43 pathways reveals:

The diversity of cellular models and pathways investigated highlights the multifaceted nature of TDP-43’s functions and its potential involvement in various aspects of neurodegeneration.

Based on our analysis, we identified seven primary pathways implicated in the cellular mechanisms of TDP-43:

  1. RNA metabolism and processing
  2. Nucleocytoplasmic transport
  3. Stress response and protein quality control
  4. Mitochondrial function
  5. Synaptic function and neurotransmitter regulation
  6. Inflammatory and immune responses
  7. Cell cycle regulation and DNA repair

These diverse pathways highlight the multifaceted role of TDP-43 in cellular function and its potential impact on various aspects of neurodegeneration.

Thematic Analysis

RNA Processing and Regulation Pathways

Study

RNA Processing Function

Specific Targets/Mechanisms

Cellular Impact

Chen, 2020

Cryptic exon splicing regulation

Repression of cryptic exons

Maintenance of normal transcriptome

Deshaies et al., 2018

Alternative splicing regulation

hnRNP A1 pre-mRNA

Production of aggregation-prone hnRNP A1B isoform

Fazal et al., 2021

RNA processing, splicing regulation

Various mRNA targets

Altered gene expression in motor neurons

Gu et al., 2019

mRNA processing

Tau mRNA

Regulation of tau mRNA stability and exon 10 inclusion

Igaz et al., 2009

RNA splicing

No mention found

The study reported abnormal RNA splicing caused by TDP-43 C-terminal fragments

Kim et al., 2010

mRNA regulation

HDAC6 mRNA

Reduced expression of HDAC6

Koehler et al., 2022

Autoregulation, RNA binding

TDP-43 mRNA

Maintenance of TDP-43 protein levels

Lauranzano et al., 2015

RNA metabolism

TARDBP RNA targets

Regulation of TDP-43 target gene expression

Ling et al., 2010

RNA processing

No mention found

The study reported enhanced interaction with FUS/TLS affecting RNA processing

Long et al., 2024

miRNA biogenesis

miRNAs

Disruption of miRNA processing through Dicer interaction

toof

Pageof

View 6 more rows

Our analysis of the included studies suggests that TDP-43 is involved in various RNA processing functions:

These findings suggest that TDP-43 plays a multifaceted role in RNA processing, potentially affecting various cellular processes through its interactions with different RNA targets.

Stress Response and Protein Quality Control Pathways

Study

Stress Response Mechanism

Protein Quality Control Function

Cellular Impact

Chen, 2020

Autophagy regulation

Regulation of ATG7 and other autophagy-related genes

Maintenance of cellular protein homeostasis

Chou et al., 2017

Stress granule dynamics

Interaction with nuclear pore complexes

Altered nucleocytoplasmic transport under stress

Feneberg et al., 2020

Stress granule formation

Interaction with stress granule proteins

Altered stress response under oxidative conditions

Feneberga et al., “Oxidative Stress in Motor Neurons”

Stress granule formation

Extracellular vesicle secretion

Impaired stress response and intercellular communication

Herzog et al., 2019

CREB signaling regulation

No mention found

Altered gene expression under stress conditions

Koehler et al., 2022

Phase separation

Autoregulation of TDP-43 levels

Maintenance of TDP-43 protein homeostasis

Luan et al., 2023

Integrated stress response activation

Regulation of stress-related gene expression

Enhanced TDP-43 aggregation and stress granule formation

Mann et al., 2019

Phase transitions

RNA binding-mediated regulation

Prevention of neurotoxic TDP-43 aggregation

McGurk et al., 2018

Stress granule localization

Interaction with poly(ADP-ribose)

Promotion of TDP-43 phase separation

Sidibé et al., 2020

Stress granule dynamics

G3BP1 mRNA stabilization

Regulation of stress granule assembly

toof

Pageof

View 3 more rows

Our analysis of the table reveals several key findings regarding TDP-43’s role in cellular stress responses:

These findings highlight the complex and multifaceted role of TDP-43 in cellular stress responses, with a particular emphasis on stress granule dynamics and phase separation processes.

Synaptic Function and Neurotransmitter Pathways

Study

Synaptic Function

Neurotransmitter Regulation

Cellular Impact

“TDP‐43 Loss of Function,” 2016

Regulation of receptor recycling

Affects ErbB4 surface delivery

Impaired trophic signaling

Heyburn and Moussa, 2016

Regulation of synaptic protein expression

Affects vesicular glutamate levels

Altered neurotransmitter release

Sephton et al., 2010

Binding to RNAs involved in synaptic function

No mention found

Regulation of synaptic gene expression

Herzog et al., 2019

Regulation of dendritic complexity

No mention found

Altered neuronal morphology and potential synaptic changes

Fazal et al., 2021

Affects axonal transport

No mention found

Potential impact on synaptic function and neurotransmitter release

toof

Pageof

Our analysis of the table reveals diverse effects of TDP-43 on synaptic function, neurotransmitter regulation, and cellular impact across the five studies:

The diversity of findings suggests that TDP-43 may have wide-ranging effects on neuronal function, affecting various aspects of synaptic activity, neurotransmitter regulation, and cellular processes. However, the lack of consistent findings across studies indicates a need for further research to establish more definitive patterns of TDP-43’s impact on neuronal function.

Pathway Interactions and Integration

Primary Pathway

Connected Pathways

Regulatory Points

Cellular Outcomes

RNA Processing

Stress Response, Synaptic Function

Splicing regulation, mRNA stability

Altered gene expression, protein homeostasis

Nucleocytoplasmic Transport

RNA Processing, Stress Response

Nuclear pore complex interactions

Disrupted RNA/protein localization, stress granule formation

Stress Response

RNA Processing, Protein Quality Control

Phase separation, stress granule dynamics

Altered stress granule assembly, protein aggregation

Mitochondrial Function

Stress Response, DNA Repair

Mitochondrial mRNA binding, unfolded protein response

Respiratory complex disruption, oxidative stress

Synaptic Function

RNA Processing, Protein Quality Control

Receptor recycling, synaptic protein expression

Altered neurotransmission, synaptic plasticity

Inflammatory Response

Stress Response, Mitochondrial Function

NF-κB and NLRP3 inflammasome activation

Microglial activation, neuroinflammation

DNA Repair

RNA Processing, Stress Response

Double-Strand Break (DSB) repair, R-loop metabolism

Genome stability, cellular survival

toof

Pageof

Our analysis of the pathway interactions and integration reveals:

The studies we analyzed suggest interconnections between multiple pathways involving TDP-43, potentially indicating its multifaceted cellular functions. These interconnections may help explain the widespread cellular dysfunction observed in TDP-43-associated neurodegenerative diseases, as disruptions in one pathway could potentially have cascading effects on others.

References

Liam Chen\ (2020).The important functional role of TDP-43 plays in amyotrophic lateral sclerosis-frontotemporal dementia. Neural Regeneration Research

L. Heyburn, C. Moussa\ (2016).TDP-43 overexpression impairs presynaptic integrity. Neural Regeneration Research

Ching-Chieh Chou, Y. Zhang, Mfon E Umoh, Spencer Vaughan, Ileana Lorenzini, and 20 more\ (2017).TDP-43 pathology disrupts nuclear pore complexes and nucleocytoplasmic transport in ALS/FTD. Alzheimer's & Dementia

Wenzhang Wang, Luwen Wang, Junjie Lu, S. Siedlak, H. Fujioka, and 10 more\ (2016).The Inhibition of TDP-43 Mitochondrial Localization Blocks Its Neuronal Toxicity. Nature Network Boston

R. Mutihac, R. Mutihac, J. Alegre-Abarrategui, D. Gordon, Lucy Farrimond, and 3 more\ (2015).\ TARDBP pathogenic mutations increase cytoplasmic translocation of TDP-43 and cause reduction of endoplasmic reticulum Ca2+ signaling in motor neurons. Neurobiology of Disease

Weihua Zhao, D. Beers, S. Bell, Jinghong Wang, Shixiang Wen, and 2 more\ (2015).TDP-43 activates microglia through NF-κB and NLRP3 inflammasome. Experimental Neurology

L. Igaz, L. Kwong, A. Chen-Plotkin, M. Winton, T. Unger, and 4 more\ (2009).Expression of TDP-43 C-terminal Fragments in Vitro Recapitulates Pathological Features of TDP-43 Proteinopathies*. Journal of Biological Chemistry

Chien-Hsiung Yu, Sophia Davidson, C. Harapas, J. B. Hilton, Michael J. Mlodzianoski, and 21 more\ (2020).TDP-43 Triggers Mitochondrial DNA Release via mPTP to Activate cGAS/STING in ALS. Cell

C. Sephton, Can Cenik, Alper Kucukural, E. Dammer, B. Cenik, and 7 more\ (2010).Identification of Neuronal RNA Targets of TDP-43-containing Ribonucleoprotein Complexes. Journal of Biological Chemistry

J. Mann, A. Gleixner, J. Mauna, Edward Gomes, M. DeChellis-Marks, and 14 more\ (2019).RNA Binding Antagonizes Neurotoxic Phase Transitions of TDP-43. Neuron

Shuo-Chien Ling, Claudio P. Albuquerque, Joo Seok Han, C. Lagier-Tourenne, Seiya Tokunaga, and 2 more\ (2010).ALS-associated mutations in TDP-43 increase its stability and promote TDP-43 complexes with FUS/TLS. Proceedings of the National Academy of Sciences of the United States of America

No authors found (2016).TDP‐43 loss of function inhibits endosomal trafficking and alters trophic signaling in neurons. EMBO Journal

Sang Hwa Kim, Naval P. Shanware, Michael J Bowler, R. Tibbetts\ (2010).Amyotrophic Lateral Sclerosis-associated Proteins TDP-43 and FUS/TLS Function in a Common Biochemical Complex to Co-regulate HDAC6 mRNA*. Journal of Biological Chemistry

Wei Luan, A. Wright, H. Brown-Wright, Sheng Le, Rebecca San Gil, and 5 more\ (2023).Early activation of cellular stress and death pathways caused by cytoplasmic TDP-43 in the rNLS8 mouse model of ALS and FTD. Molecular Psychiatry

Xing Sun, Yongjia Duan, Caixia Qin, Jian-Chiuan Li, Gang Duan, and 8 more\ (2018).Distinct multilevel misregulations of Parkin and PINK1 revealed in cell and animal models of TDP-43 proteinopathy. Cell Death and Disease

L. McGurk, Edward Gomes, Lin Guo, J. Mojsilovic-Petrovic, V. Tran, and 3 more\ (2018).Poly(ADP-Ribose) Prevents Pathological Phase Separation of TDP-43 by Promoting Liquid Demixing and Stress Granule Localization. Molecules and Cells

Josiah J. Herzog, Weijin Xu, Mugdha Deshpande, Reazur Rahman, H. Suib, and 3 more\ (2019).TDP-43 dysfunction restricts dendritic complexity by inhibiting CREB activation and altering gene expression. Proceedings of the National Academy of Sciences of the United States of America

Hadjara Sidibé, Yousra Khalfallah, S. Xiao, N. Gómez, Hana Fakim, and 15 more\ (2021).TDP-43 stabilizes G3BP1 mRNA: relevance to amyotrophic lateral sclerosis/frontotemporal dementia. Brain : a journal of neurology

E. Feneberg, D. Gordon, A. Thompson, M. Finelli, R. Dafinca, and 9 more\ (2020).An ALS-linked mutation in TDP-43 disrupts normal protein interactions in the motor neuron response to oxidative stress. Neurobiology of Disease

María M. Leal‐Lasarte, Jaime M Franco, A. Labrador-Garrido, D. Pozo, C. Roodveldt\ (2017).Extracellular TDP‐43 aggregates target MAPK/MAK/MRK overlapping kinase (MOK) and trigger caspase‐3/IL‐18 signaling in microglia. The FASEB Journal

Xiang Long, Mengni Jiang, Yongzhen Miao, Huanhuan Du, Ting Zhang, and 4 more\ (2024).TDP-43 mutations-induced defects in miRNA biogenesis and cytotoxicity by differentially obstructing Dicer activity in Drosophila and in vitro. bioRxiv

Y. Ayala, T. Misteli, F. Baralle\ (2008).TDP-43 regulates retinoblastoma protein phosphorylation through the repression of cyclin-dependent kinase 6 expression. Proceedings of the National Academy of Sciences of the United States of America

G. P. Ritson, Sara K Custer, Brian D. Freibaum, Jake B. Guinto, D. Geffel, and 8 more\ (2010).TDP-43 Mediates Degeneration in a Novel Drosophila Model of Disease Caused by Mutations in VCP/p97. Journal of Neuroscience

Zhipeng Yu, D. Fan, B. Gui, Lei Shi, C. Xuan, and 4 more\ (2012).Neurodegeneration-associated TDP-43 Interacts with Fragile X Mental Retardation Protein (FMRP)/Staufen (STAU1) and Regulates SIRT1 Expression in Neuronal Cells*. Journal of Biological Chemistry

Emily Feneberga, David Gordona, Alexander G. Thompsona, Mattéa J. Finellia, Ana Candalijaa, and 8 more\ (2020).Neurobiology of Disease An ALS-linked mutation in TDP-43 disrupts normal protein interactions in the motor neuron response to oxidative stress

Peng Wang, Jianwen Deng, Jie Dong, Jianghong Liu, E. Bigio, and 10 more\ (2019).TDP-43 induces mitochondrial damage and activates the mitochondrial unfolded protein response. PLoS Genetics

Kaitlin Weskamp, Elizabeth H M Tank, R. Miguez, Jonathon P. McBride, N. Gómez, and 6 more\ (2019).Shortened TDP43 isoforms upregulated by neuronal hyperactivity drive TDP43 pathology in ALS. bioRxiv

Jade-Emmanuelle Deshaies, L. Shkreta, A. Moszczynski, Hadjara Sidibé, Sabrina Semmler, and 15 more\ (2018).TDP-43 regulates the alternative splicing of hnRNP A1 to yield an aggregation-prone variant in amyotrophic lateral sclerosis. Brain : a journal of neurology

Nicole F. Liachko, P. McMillan, T. Strovas, Elaine Loomis, Lynne Greenup, and 7 more\ (2014).The Tau Tubulin Kinases TTBK1/2 Promote Accumulation of Pathological TDP-43. PLoS Genetics

Hadjara Sidibé, Yousra Khalfallah, S. Xiao, N. Gómez, Elizabeth H M Tank, and 14 more\ (2020).TDP-43 stabilizes transcripts encoding stress granule protein G3BP1: potential relevance to ALS/FTD. bioRxiv

J. Mitra, Erika N. Guerrero, Erika N. Guerrero, Pavana M. Hegde, Nicole F. Liachko, and 15 more\ (2019).Motor neuron disease-associated loss of nuclear TDP-43 is linked to DNA double-strand break repair defects. Proceedings of the National Academy of Sciences of the United States of America

Giulia Romano, Raffaella Klima, F. Feiguin\ (2020).TDP-43 prevents retrotransposon activation in the Drosophila motor system through regulation of Dicer-2 activity. BMC Biology

Y. Ke, Annika van Hummel, Carol Au, Gabriella Chan, W. S. Lee, and 16 more\ (2024).Targeting 14-3-3θ-mediated TDP-43 pathology in amyotrophic lateral sclerosis and frontotemporal dementia mice. Neuron

Jianlan Gu, Dandan Chu, Nana Jin, Feng Chen, Fei Liu\ (2019).Cyclic AMP-Dependent Protein Kinase Phosphorylates TDP-43 and Modulates Its Function in Tau mRNA Processing. Journal of Alzheimer's Disease

Seiji Watanabe, Hidekazu Inami, K. Oiwa, Yuri Murata, Shohei Sakai, and 5 more\ (2020).Aggresome formation and liquid–liquid phase separation independently induce cytoplasmic aggregation of TAR DNA-binding protein 43. Cell Death and Disease

Ching-Chieh Chou, Y. Zhang, Mfon E Umoh, Spencer Vaughan, Ileana Lorenzini, and 20 more\ (2018).TDP-43 pathology disrupts nuclear pore complexes and nucleocytoplasmic transport in ALS/FTD. Nature Neuroscience

L. Koehler, Z. Grese, Alliny C S Bastos, Lohany D. Mamede, T. Heyduk, and 1 more\ (2022).TDP-43 Oligomerization and Phase Separation Properties Are Necessary for Autoregulation. Frontiers in Neuroscience

T. Afroz, Elodie Chevalier, M. Audrain, C. Dumayne, T. Ziehm, and 21 more\ (2023).Immunotherapy targeting the C-terminal domain of TDP-43 decreases neuropathology and confers neuroprotection in mouse models of ALS/FTD. Neurobiology of Disease

Raheem Fazal, Steven Boeynaems, A. Swijsen, Mathias De Decker, L. Fumagalli, and 14 more\ (2021).HDAC6 inhibition restores TDP‐43 pathology and axonal transport defects in human motor neurons with TARDBP mutations. EMBO Journal

E. Lauranzano, S. Pozzi, L. Pasetto, Riccardo Stucchi, Tania Massignan, and 8 more\ (2015).Peptidylprolyl isomerase A governs TARDBP function and assembly in heterogeneous nuclear ribonucleoprotein complexes. Brain : a journal of neurology

Download BIBDownload RISDownload TXT

Report

Status

Gather sources

493 sources found

Details

Screen sources

40 sources included

Details

Extract data

120 data points extracted

Details

Generate report

Save PDF

BIBLaTeX, ZoteroRISZotero, MendeleyTXTAPA BibliographyPDFPDFDOCXMicrosoft Word

Chat

Got some follow-up questions?

Sign up or sign in to chat with this report.

Back

TDP-43 pathology disrupts nuclear pore complexes and nucleocytoplasmic transport in ALS/FTD

Ching-Chieh Chou, Y. Zhang, Mfon E Umoh, Spencer Vaughan, Ileana Lorenzini, Feilin Liu, Melissa R. Sayegh, Paul G. Donlin-Asp, Yu Han Chen, D. Duong, N. Seyfried, M. Powers, Thomas Kukar, Chadwick M. Hales, M. Gearing, N. Cairns, K. Boylan, D. Dickson, R. Rademakers, Yong-Jie Zhang, L. Petrucelli, R. Sattler, Daniela C. Zarnescu, J. Glass, W. Rossoll

Alzheimer's & Dementia·

2017·

412 citations

SourceDOI

Plain textPDFFigures

Searching for PDF

Unable to find PDF from source

Back

Specific Biological Pathways Involving TDP-43

- Nucleocytoplasmic transport - RNA processing and splicing regulation - Nuclear protein import - Nuclear RNA export

Molecular Interactions and Binding Partners of TDP-43

- Interacts with components of the nuclear pore complex (NPC) - Interacts with nucleocytoplasmic transport machinery - Coaggregates with phenylalanine-glycine (FG) repeat-containing nucleoporins (Nups) - Coaggregates with scaffold Nups and nuclear export factors - Prion-like domains (PrLDs) in Nup98 and Nup214 mediate coaggregation

Functional Consequences of TDP-43 Interactions

Disrupts nucleocytoplasmic transport, causes cytoplasmic mislocalization of nucleoporins and transport factors, impairs nuclear protein import and RNA export, leads to morphological defects in nuclear membrane and pore complexes, causes nuclear retention of poly(A) RNA, increases DNA damage, mislocalizes LINC proteins, and disrupts F-actin integrity.

The cytoplasmic mislocalization and aggregation of TAR DNA-binding protein-43 (TDP-43) is a common histopathological hallmark of the amyotrophic lateral sclerosis and frontotemporal dementia disease spectrum (ALS/FTD). However, the composition of aggregates and their contribution to the disease process remain unknown. Here we used proximity-dependent biotin identification (BioID) to interrogate the interactome of detergent-insoluble TDP-43 aggregates and found them enriched for components of the nuclear pore complex and nucleocytoplasmic transport machinery. Aggregated and disease-linked mutant TDP-43 triggered the sequestration and/or mislocalization of nucleoporins and transport factors, and interfered with nuclear protein import and RNA export in mouse primary cortical neurons, human fibroblasts and induced pluripotent stem cell–derived neurons. Nuclear pore pathology is present in brain tissue in cases of sporadic ALS and those involving genetic mutations in TARDBP and C9orf72. Our data strongly implicate TDP-43-mediated nucleocytoplasmic transport defects as a common disease mechanism in ALS/FTD. Pathological TDP-43 protein aggregates are a hallmark of amyotrophic lateral sclerosis and frontotemporal dementia. TDP-43 pathology alters the morphology of nuclear pore complexes and cause deficits in nucleocytoplasmic transport.

Articles

NATuRe NeuROScIeNce membrane (NM) and nuclear pore complexes (NPCs), leading to reduced nuclear protein import and mRNA export. In addition, mutations in Nup genes acted as genetic modifiers in Drosophila melanogaster models of TDP-43 proteinopathy. Our findings of Nup205 pathology in brain tissue from sporadic ALS (sALS) and TARDBP mutation-associated ALS (TDP-ALS) point to nucleocytoplasmic transport defects caused by TDP-43 pathology as a common disease mechanism in ALS/FTD, and potentially other TDP-43 proteinopathies.

Results

Cytoplasmic TDP-43 aggregates are enriched for components of nucleocytoplasmic transport pathways. A 25-kDa C-terminal fragment of TDP-43 (TDP-CTF) generated by proteolytic cleavage at Arg208 is found as a major component of insoluble cytoplasmic aggregates in ALS/FTD patients' brain tissue 3 . Its expression as a fusion protein in vitro recapitulates histopathological features present in human patients [9][10][11] . To characterize changes in the interaction partners of TDP-43 under normal and pathological conditions, we used the BioID approach, which is based on the fusion of a promiscuous mutant of Escherichia coli biotin ligase (BirA*) to proteins of interest and catalyzes the biotinylation of proximate proteins in the natural cellular environment 12,13 .

To determine physiological and aggregate-specific interacting partners of TDP-43, we transfected Neuro-2A (N2a) neuroblastoma cells with expression vectors for myc-BirA*-tagged human TDP-43 (myc-BirA*-TDP-43) or TDP-CTF (myc-BirA*-TDP-CTF) (Fig. 1a ). Cells were incubated with excess biotin in the culture media to induce biotinylation of proximate proteins (Supplementary Fig. 1a, b ), followed by denaturing lysis in 8 M urea, to solubilize protein aggregates, and affinity purification via neutravidin beads (Fig. 1b ). Biotinylated proteins colocalized with myc-BirA*-TDP-43 in the nucleus and with myc-BirA*-TDP-CTF in cytoplasmic aggregates that were positive for hyperphosphorylated TDP-43 (pTDP-43 Ser409/Ser410), ubiquitin and p62/SQSTM1 (Fig. 1c and Supplementary Fig. 1c, d ). Proximity-dependent biotinylation of myc-BirA*-TDP-43-and myc-BirA*-TDP-CTF-associated proteins showed distinct patterns in western blots (Fig. 1d ).

Affinity-purified biotinylated proteins were subjected to unbiased proteomic analysis. We found 254 proteins associated with myc-BirA*-TDP-43 and 389 proteins associated with myc-BirA*-TDP-CTF (Fig. 2a ). Clustering analysis of the TDP-43-or TDP-CTF-associated proteome versus a mock-transfected control based on gene ontology (GO) in DAVID identified distinct categories of strongest interacting proteins. The top categories in the TDP-43/ Mock comparison were mRNA processing and splicing, whereas

those in the TDP-CTF/Mock comparison were intracellular protein transport and translation initiation (Supplementary Fig. 2a, b ). We further characterized the differences in the function-specific enrichment and interaction networks by comparing the TDP-CTF-and TDP-43-associated proteomes (Fig. 2b, c ). Proteins involved in mRNA processing primarily associated with TDP-43 (Supplementary Fig. 2c ), whereas the TDP-CTF associated proteome was enriched for proteins involved in intracellular transport (Supplementary Fig. 2d ). Our network analysis also showed comparable results in biological processes (Supplementary Fig. 3 ). Notably, we identified components of nucleocytoplasmic transport pathway as a major subset of protein interactors within TDP-CTF aggregates (Fig. 2d ).

TDP-43 pathology causes the cytoplasmic aggregation and mislocalization of Nups and TFs. NPCs are multiprotein channels that act as gatekeepers regulating the receptor-mediated nucleocytoplasmic transport of macromolecules. NPCs contain ~30 different Nups and are among the largest proteinaceous assemblies in the eukaryotic cell 14 . To confirm putative TDP-CTF-associated proteins detected in our proteomic screen, we coexpressed Nups or TFs together with TDP-CTF in N2a cells. We identified four different

Articles

NATuRe NeuROScIeNce interaction patterns, as summarized in the schematic of the NPC (Fig. 2e and Supplementary Figs. 4 and 5 ): (1) coaggregation with TDP-CTF was predominantly found for phenylalanine-glycine (FG) repeat-containing Nups, scaffold Nups and nuclear export factors;

(2) mislocalization but no coaggregation was found in transmembrane Nups and nuclear lamina proteins, indicating a major structural disruption of the NPCs; (3) Nup85, Tpr and Kpnb1 caused disaggregation of TDP-CTF; and (4) there was no or only a minor effect on the nuclear FG-Nups as well as nuclear import factors. A list of coaggregation scores is presented in Supplementary Table 1 . ALS-linked missense mutations, such as Q331K and M337V, increase cytoplasmic TDP-43 mislocalization and neurotoxicity 15 . To test whether wild-type TDP-43 (TDP-43 WT ) or mutant TDP-43 affect the localization of Nups and TFs, we expressed Nups or TFs together with TDP-43 WT or TDP-43 Q331K in N2a cells. Both TDP-43 WT and TDP-43 Q331K triggered the cytoplasmic aggregation of Nup62, whereas TDP-43 Q331K increased the propensity for cytoplasmic mislocalization of Nup98 and cytoplasmic aggregation of Nup93, Nup107 and Nup214 (Supplementary Fig. 6 ). Our results show that TDP-CTF alters the cellular localization of nucleocytoplasmic transport proteins to varying degrees. Although mutant TDP-43 does not induce visible aggregates in this cell culture model, it can still compromise the localization of a subset of FG-Nups.

FG-Nups contain prion-like domains (PrLDs) that mediate the cytoplasmic coaggregation with TDP-CTF. TDP-43 harbors a low-complexity domain and PrLD at the C terminus, which contributes to self-assembly and protein-protein interactions 8 . PrLDs are frequently found in transcription factors and RNA-binding proteins 16 , but have been recently identified in the FG-rich domains of yeast Nups 17 . FG repeats are also present in mammalian Nups and form amyloid-like interactions within sieve-like hydrogels and natively unfolded sites that act as effective barriers to normal macromolecules, but are permeable to shuttling nuclear transport receptor complexes 18 .

We used the PLAAC algorithm and other online tools (see Methods) to identify prion-like and low-complexity sequences in human Nups and TFs. Quantitative analysis revealed the presence of a PrLD and low-complexity domain in the hydrogel-forming Nup214 19 and other FG-Nups including Nup54, Nup98, Nup153 and Nup358, but not Nup50 (Supplementary Fig. 7 ). To investigate whether PrLDs can mediate the coaggregation with TDP-CTF, we generated and coexpressed the PrLD or non-PrLD fragment of Nup98, Nup153 and Nup214. We found that PrLDs of Nup98 and Nup214 were both required and sufficient to mediate cytoplasmic coaggregation (Supplementary Fig. 8 ). Notably, although Nup153 PrLD had a weak coaggregation tendency with TDP-CTF, it caused dramatic mislocalization of both exogenous and endogenous fulllength TDP-43.

TDP-43 pathology disrupts the morphology of the NM and NPCs. To visualize the nuclear morphology of transfected cells

NATuRe NeuROScIeNce

at high resolution in electron microscopy, we fused TDP-43 and TDP-CTF to the engineered peroxidase APEX2, which functions as an electron microscopy tag 20 (Fig. 3a ). APEX2-TDP-CTF formed pTDP-43-positive aggregates in the cytosol (Fig. 3b ). Irregular nuclear morphology with invaginated NMs was observed only in cells expressing APEX2-TDP-CTF or GFP-TDP-CTF (Fig. 3c ).

To further investigate morphological deficits in the NM and NPCs, we used fluorescence microscopy on mouse primary cortical neurons expressing GFP or GFP-tagged TDP-CTF, TDP-43 WT , ALSlinked mutants (TDP-43 Q331K and TDP-43 M337V ) or an NLS mutant (TDP-43 mtNLS ). Aggregated and mutant TDP-43 caused cytoplasmic mislocalization and/or aggregation of endogenous FG-Nups concomitant with morphological abnormalities in the NM stained with anti-lamin B antibody (Fig. 4a ). A total of 43% of TDP-CTFexpressing cells and 29 to 36% of mutant TDP-43-expressing cells exhibited abnormal lamin B staining (Fig. 4b ). 3D reconstruction of nuclei stained with anti-lamin B antibody further confirmed the deep invaginations of the NM in the presence of TDP-CTF aggregates (Supplementary Fig. 9a and Supplementary Videos 1 and 2). Knockdown of TDP-43 did not cause obvious NM defects in our primary neuron model (Fig. 4c ), whereas morphological nuclear defects were previously reported in the TDP-43-depleted HeLa cells 21 . While this could be caused by a very severe reduction (> 90%) of this essential RNA-binding protein leading to increased apoptosis, a dual gain-and loss-of-function mechanism leading to NM defects cannot be excluded. Abnormal RanGAP1 staining was observed only in the cells expressing TDP-CTF or TDP-43 mtNLS (Fig. 4d and Supplementary Fig. 9b ).

To clearly resolve the distribution of NPCs under normal and pathological conditions, we employed super-resolution structuredillumination microscopy (SIM). We found severely disturbed Nup98 distribution in the NM of N2a cells expressing GFP-TDP-CTF, with signs of NPC clustering in some parts of the NM (Fig. 4e ). These strong defects in the nuclear morphology and the localization of Nups and TFs caused by aggregated or mutant TDP-43 suggested a consequential effect on nucleocytoplasmic transport processes.

The nuclear lamina helps maintain nuclear morphology, anchor NPCs, organize chromatin and trigger DNA repair 22 . We found that the impaired lamina structure in TDP-CTF-expressing neurons was associated with increased immunoreactivity for γ H2AX, a marker for DNA double-strand breaks (Fig. 4f ). There was a modest but significant difference between TDP-CTF and TDP-43 WT (1.7-fold increase) or TDP-43 Q331K (1.5-fold increase). Laminopathy-related DNA damage has also been observed in Alzheimer's disease with tau pathology 23 , suggesting that lamin dysfunction may be frequently associated with neurodegeneration. To anchor the nuclear lamina to the inner NM, lamins are tethered to the cytoskeleton through the LINC (linkers of nucleoskeleton and cytoskeleton) complex 24,25 . We found that expression of TDP-CTF and TDP-43 Q331K caused the mislocalization of the LINC proteins sun2 and nesprin-2, as well as a loss of F-actin integrity in cortical neurons (Supplementary Fig. 9c-f ). These data suggest that TDP-43 pathology causes the disruption of the nuclear lamina by interfering with the structural support from LINC complex proteins and the peripheral cytoskeleton.

TDP-43 pathology disrupts nuclear import of proteins and export of mRNA.

To examine nuclear protein import, we coexpressed GFP or GFP-TDP-43 with a fluorescent reporter protein flanked by NES and NLS sequences (NES-tdTomato-NLS) in primary cortical neurons. Quantitative analysis revealed a significant reduction of the nuclear-to-cytoplasmic (N-to-C) ratio of the reporter in cells expressing TDP-CTF or TDP-43 mutants compared to GFP control (Fig. 4g, h ), indicating the cytoplasmic accumulation of reporter protein in the cells. Treatment with the nuclear import inhibitor importazole reduced the N-to-C ratio of the reporter to a similar degree, whereas staurosporine-induced apoptosis did not, thus ruling out the possibility that the observed protein import defects were caused by cell death (Fig. 4i ). We also found that short hairpin RNA-mediated reduction of TDP-43 lowered the N-to-C ratio of reporter (Fig. 4j ). However, the N-to-C ratio of Ran was not obviously affected by TDP-43 (Fig. 4k ). Compared to TDP-43 WT , a significant reduction of the N-to-C ratio of TDP-43 and increases in cytoplasmic TDP-43 levels for TDP-43 M337V and TDP-43 mtNLS (TDP-43 M337V /TDP-43 WT : 1.3-fold, TDP-43 mtNLS /TDP-43 WT : 4.3-fold) were also observed (Supplementary Fig. 10a-c ). The moderate but significant correlation of the N-to-C ratio of reporter to the N-to-C ratio of TDP-43 and the cytoplasmic TDP-43 levels (Supplementary Fig. 10d-f ) suggest that subcellular TDP-43 levels need to be tightly regulated and that a relative increase in cytoplasmic TDP-43 levels may compromise nuclear protein import. To investigate whether TDP-43 pathology affects nuclear RNA export, we quantified poly(A) RNA levels in both nucleus and cytoplasm. Expression of TDP-CTF and TDP-43 mutants caused nuclear retention of poly(A) RNA, indicating impaired nuclear RNA export (Fig. 4l ,m 4 .

NATuRe NeuROScIeNce

and Supplementary Fig. 10g ). As a likely consequence of this defect, we observed a significant reduction of steady-state levels of protein translation in cells expressing TDP-43 WT or TDP-CTF, as measured by metabolic labeling of newly synthesized proteins (Fig. 4n ).

We next assessed the effect of TDP-43 pathology at the endogenous levels in fibroblasts from three (per group) sALS, TDP-ALS and C9orf72 mutation-associated ALS (C9-ALS) and healthy control subjects. Super-resolution imaging revealed evenly distributed FG-Nups and round-shaped lamin B staining in controls, while clustered FG-Nups and irregular and fragmented lamin B staining were present in TDP-ALS (Fig. 5a ). γ H2AX immunoreactivity increased by 1.6-fold in TDP-ALS compared to control (Fig. 5b ). The distribution pattern of Nup205 was altered in C9-ALS and TDP-ALS fibroblasts, which exhibited significantly increased abnormal lamin B staining (17% and 22%), whereas sALS cells showed a trend for increase (Fig. 5c, d ). Quantitative analysis further showed a significant reduction of the N-to-C ratio of reporter (Fig. 5e, f ) and nuclear retention of poly(A) RNA (Fig. 5g, h ) in ALS samples. Induced pluripotent stem cell (iPSC)-derived motor neurons from healthy control and TDP-ALS showed significant increases in the percentage of TDP-ALS cells with mislocalized FG-Nups and distorted lamin B with increased immunoreactivity (Fig. 5i, j ). These data suggest that the defects in the nucleocytoplasmic transport pathway are consistently observed in cortical neurons with ectopic expression of aggregated or mutant TDP-43, in fibroblasts and iPSC-derived neurons from subjects with ALS, as well as in a mechanistic ALS mouse model 26 . The dysregulation of nucleocytoplasmic shuttling and disruption of the NM and NPCs may be a common mechanism in both sALS and familial ALS (fALS) exhibiting TDP-43 proteinopathy.

that found in spinal motor neurons of ALS patients 28 . Overexpression of human TDP-43 WT or TDP-43 G298S led to retinal degeneration and larval motor dysfunction (Fig. 6a, b ). In addition to a Nup50 mutation previously implicated as a genetic suppressor of TDP-43 toxicity 29 , we identified several loss-of-function mutations in Nup genes that suppressed TDP-43-mediated eye phenotypes, including Nup93, Nup98-96, Nup107 and Nup214 (Fig. 6a ). In larval turning assays, these mutations also rescued the locomotor dysfunction caused by TDP-43 WT or TDP-43 G298S expression in motor neurons (Fig. 6b ).

The results show that at least some aspects of TDP-43 toxicity in vivo depend on the nucleocytoplasmic transport machinery.

Nuclear pore pathology is common in ALS patient brain tissue with TDP-43 proteinopathy. We next investigated the presence of nuclear pore pathology in patient brain tissue with pTDP-43-positive inclusions, including subjects with sALS, TDP-ALS and C9-ALS (Supplementary Fig. 11a and Supplementary Table 2 ). To investigate the connection between TDP-43 and Nup pathology, we also stained the motor cortex from one subject with SOD1-associated ALS (SOD1-ALS) and cerebellum from subjects with TDP-ALS and sALS, which acted as pTDP-43-negative controls (Supplementary Fig. 11b ). Indeed, in the motor cortex, TDP-ALS and sALS tissues but not age-matched controls showed a widespread loss of Nup205 immunoreactivity and large Nup205-positive cytoplasmic inclusions, whereas neurons in C9-ALS tissues exhibited abnormal perinuclear punctate staining (Fig. 7a ). We found colocalization of Nup205 with pTDP-43-posive-inclusions in the motor cortex and more frequently in the hippocampus in TDP-ALS, suggesting partial coaggregation (Fig. 7b, c ). Cytoplasmic Nup205-positive inclusions were also observed in the frontal cortex in ALS (Supplementary Fig. 12 ). However, neither the SOD1-ALS motor cortex nor any cerebellum exhibited Nup205 pathology (Fig. 7a, d ).

Notably, samples from one of the two subjects with TDP-ALS showed no pTDP-43-positive inclusions in the motor cortex 30 and were also devoid of Nup205 pathology. Abnormal NM morphology was occasionally present in the motor cortex in TDP-ALS but scarcely found in C9-ALS and sALS (Supplementary Fig. 13 ). However, we did not observe obvious defects in RanGAP1 staining among our cohort (Supplementary Fig. 14 ). These data show that nuclear pore pathology may be a histopathological hallmark of fALS and sALS in the presence of TDP-43 proteinopathy, even in the absence of C9orf72 repeat expansion.

Suppression of TDP-43 toxicity rescues nucleocytoplasmic transport defects in vitro and in vivo.

To assess pharmacological rescue of nucleocytoplasmic transport defects in TDP-43 pathology, we used a selective inhibitor, KPT-335 (verdinexor), which interferes with the Xpo1/Crm1-dependent nuclear export pathway. KPT-335 was reported to inhibit influenza virus 31 and TNF-α neurotoxicity 32 . The related compound KPT-276 has previously shown neuroprotection in C9-ALS 33 , and KPT-350 has done so in Huntington's disease 34 . We have previously shown that aggregated and mutant 4 .

NATuRe NeuROScIeNce

TDP-43 increases neurotoxicity in primary cortical neurons 10 .

Treatment with 50 nM KPT-335 significantly suppressed 55 to 62% of cell death caused by TDP-CTF or TDP-43 Q331K in cortical neurons, whereas 150 nM KPT-335 resulted in a trend for increased toxicity (Fig. 8a ). The defects in nuclear morphology caused by TDP-CTF were also rescued by the treatment with 50 nM KPT-335 (Fig. 8b ). Larval locomotor defects caused by human TDP-43 WT or TDP-43 G298S were also ameliorated by treatment with 1 μ M but not 5 μ M KPT-276 or KPT-335 (Fig. 8c ). Previously, we had identified poly(A)-binding protein nuclear 1 (PABPN1) as a potent suppressor of TDP-43 toxicity and aggregation that acts via a proteasome-dependent mechanism 10 . To assess its ability to rescue nucleocytoplasmic transport defects, we coexpressed TDP-CTF with PABPN1 in cortical neurons. PABPN1 overexpression not only led to the clearance of soluble and insoluble TDP-CTF (Supplementary Fig. 15a ), but also restored the proper localization of endogenous FG-Nups and lamin B (Supplementary Fig. 15b, c ). TDP-CTF-mediated defects in nuclear protein import (Supplementary Fig. 15d ) and mRNA export (Supplementary Fig. 15e ) were also rescued. These results suggest that suppression of TDP-43 toxicity via pharmacological or molecular inhibition may be a valid strategy for rescuing the defective nucleocytoplasmic transport function.

Discussion

Here we have established a modified BioID procedure as a method to interrogate the proteome of insoluble aggregates associated with neurodegenerative diseases. Our study provides evidence that (1) proteins involved in nucleocytoplasmic transport are major components of pathological TDP-43 aggregates, (2) aggregated and mutant TDP-43 cause cytoplasmic mislocalization and/or aggregation of Nups and TFs, (3) PrLDs present in human Nups containing FG repeats are required and sufficient for coaggregation, (4) aggregated and mutant TDP-43 trigger morphological defects in the NM and NPCs, as well as functional defects in nuclear protein import and mRNA export, (5) several Nup genes act as genetic modifiers of TDP-43 toxicity in Drosophila, (6) pharmacological and molecular inhibition of TDP-43 toxicity rescue nucleocytoplasmic transport defects and (7) nuclear pore pathology is present in motor and frontal cortex in sALS and fALS with pTDP-43-positive inclusions, suggesting that defective nucleocytoplasmic transport represents a common neuropathological hallmark in ALS and potentially other TDP-43 proteinopathies.

The specific composition of TDP-43 aggregates has remained unknown, perhaps due to technical limitations in preserving protein interactions under the harsh lysis conditions required for the extraction of insoluble aggregates. To address this question, we adapted a method for proximity-based biotinylation of proteins for the characterization of pathological aggregates 12,13 . The high affinity of streptavidin and neutravidin for biotin allowed us to purify biotinylated proteins under the strong denaturing condition required for solubilizing protein aggregates. Robust labeling of proteins in detergent-insoluble aggregates suggests that this method has a broad applicability for the study of a wide range of neuropathological inclusions. Our proteomic analysis of pathological TDP-43 aggregates led to the unexpected discovery that cytoplasmic TDP-43 aggregates are highly enriched for components of NPCs, as well as TFs. Our findings imply that TDP-43 may not only be mislocalized as a consequence of defects in nucleocytoplasmic transport, but also directly inhibit the nuclear import and export of macromolecules by sequestering components in this pathway. In addition, proteins involved in vesicular trafficking between endoplasmic reticulum and Golgi were also enriched in the TDP-CTF interactome (Supplementary Fig. 2 ). Of note, endoplasmic reticulum-Golgi transport dysfunction was found associated with various ALS mutations 35 . TDP-43 mutation had also been reported to compromise axonal mRNA transport in human motor neurons 36 , suggesting that deficits in multiple intracellular trafficking could be linked to the pathogenesis of ALS/FTD.

Although pathogenic mechanisms related to Nups have been widely studied in a variety of diseases 37 , little is known about their role in neurodegeneration. The first evidence related to ALS addressed a loss of Kpnb1 immunoreactivity and ruffled nuclear morphology upon staining with Nup62 and Nup153 antibodies in spinal motor neurons in sALS 28 . Mutations in the Gle1 gene, encoding an essential RNA export factor, were found to be associated with ALS and cause a deficit in motor neuron development in zebrafish upon its loss of function 38 . Notably, several recent studies have linked ALS/FTD caused by an intronic G 4 C 2 hexanucleotide repeat expansion in the C9orf72 locus to nucleocytoplasmic transport defects. Expression of 30 G 4 C 2 repeats resulted in retinal degeneration in a Drosophila model of C9-ALS. One of the proposed mechanisms was the sequestration of RanGAP1 into G 4 C 2 RNA foci, which interfered with Ran-dependent nucleocytoplasmic transport 33 . Additionally, unbiased genetic screens identified components of the nucleocytoplasmic transport machinery as genetic modifiers of C9orf72 toxicity in Drosophila expressing (G 4 C 2 ) 58 and in yeast expressing poly(Pro-Arg) 50 39,40 . Poly(Gly-Ala) forms intracellular aggregates that were found to sequester nuclear pore proteins, such as Pom121, in a new C9-ALS mouse model 41 . Additionally, several Nups, such as Pom121 and Nup107, are very long-lived proteins in postmitotic cells and susceptible to oxidative insults. The poor turnover of damaged Nups as well as age-dependent decline of TFs may result in irreversible neuronal dysfunction and death 42,43 . Taken together, these studies suggest that defects in the nucleocytoplasmic transport machinery may be central to the pathogenesis of C9-ALS.

Notably, several of these studies suggest that defects in nuclear transport leads to TDP-43 cytoplasmic mislocalization as a consequence. Ran has been identified as an essential regulator of TDP-43 nuclear localization 44 . The expression of (G 4 C 2 ) 30 RNA impairs the NM morphology and reduces the N-to-C Ran gradient. The reduction of nuclear Ran was found to be correlated with the nuclear depletion of TDP-43 in C9-ALS iPSC-derived neurons and a GRN knockout mouse model 33,44 . The short interfering RNA-mediated reduction of Nup62, CAS or Kpnb1 levels also triggers cytoplasmic accumulation of TDP-43 45 .

In this study, however, we show that TDP-43 pathology itself triggers structural defects in the NM and NPCs, with ensuing impairment of nucleocytoplasmic transport in mouse primary cortical neurons, as well as fibroblasts and iPSC-derived neurons from ALS patients. This is further supported by our observation of nuclear pore pathology in the brain tissues from pTDP-43-positive sALS and TDP-ALS but not those that are pTDP-43 negative. Altered nuclear morphology has also been observed in brain samples of TDP-43 transgenic mice and in human cases of frontotemporal lobar degeneration-TDP 46 . Our data suggest a common role for NM and NPC pathology in the disease mechanism of most ALS/FTD cases. A broader role for nucleocytoplasmic transport defects in age-dependent neurodegeneration is further supported by the finding that the cytoplasmic aggregation of artificial β -sheet proteins, as well as fragments of mutant huntingtin and TDP-43, can interfere with mRNA export in HEK293T cells and mouse primary cortical neurons. This deficit may result from mislocalization of a subunit of the THO complex (THOC2), which is involved in mRNA export 47 . Notably, cytoplasmic but not nuclear β -sheet protein triggers cellular toxicity and the mislocalization of nuclear transport factors and poly(A) RNA. Notably, an altered localization of Nups and TFs and nucleocytoplasmic transport function was also found as an age-dependent phenotype in a mutant huntingtin knock-in mouse model and Huntington's disease patients 34,48 . These results suggest that several disease-associated protein aggregates can impair the NPC integrity and nucleocytoplasmic transport function. However, how protein

NATuRe NeuROScIeNce

aggregates in distinct compartments share a similar pathogenic mechanism in various diseases remains to be investigated in detail.

As a possible mechanistic explanation, we have identified PrLDs and low-complexity domains similar to those frequently found in RNA-binding proteins within FG-rich domains of several human Nups. These domains were both required and sufficient for coaggregation with TDP-CTF. Notably, the arginine-rich dipeptide repeats, including poly(Pro-Arg) and poly(Gly-Arg), can interact with membraneless organelles, such as nucleoli, NPCs and stress granules, through the low-complexity domains and disrupt organelle function and dynamics 49 . The sorting capability of NPCs is driven by the phase separation of FG domains into dense and sieve-like hydrogels. A similar phase separation process driven by low-complexity domains has also been recognized in stress granule formation and the pathological transition to insoluble aggregates, making this process an important emerging principle in neurodegeneration 50 . Our findings suggest that the interaction of PrLDs in TDP-43 and those in FG-Nups may trigger the pathological cascade in a similar way.

We found that many Nups and TFs were affected by TDP-43 pathology. Notably, some components of the nucleocytoplasmic transport machinery were not affected, but instead prevented the cytoplasmic aggregation of TDP-CTF. The most pronounced effect was found for Kpnb1, which is involved in nuclear import in concert with NLS-binding Kpna proteins. A previous screen of 82 proteins involved in nuclear transport found that downregulation of Kpnb1 causes cytoplasmic accumulation of TDP-43 45 .

Here we identified several genetic suppressors in our fly system. Among these, Nup98-96 and Nup107 mutations have been previously shown to reduce G 4 C 2 -mediated toxicity 39 . In a search for candidate genes near the gene locus of Hey, a Nup50 mutation was found to rescue the lifespan of TDP-43 transgenic flies 29 . The reduced expression of Nup genes may compensate the defects in nucleocytoplasmic transport and ameliorate TDP-43 toxicity by reducing cytoplasmic shuttling of TDP-43. We also found that pharmacological treatment with the selective nuclear export inhibitors KPT-276 and KPT-335 rescued TDP-43 toxicity and defective nucleocytoplasmic transport function in cortical neurons and Drosophila, similarly to its effect in C9-ALS models 33 , suggesting a potential therapeutic application in most ALS cases.

Taken together, our data suggest that the disruption of the NM and NPCs and nucleocytoplasmic transport function may be a common pathogenesis in most ALS and most FTD with TDP-43 proteinopathy. Based on our findings, we propose that (1) cytoplasmic mislocalization of TDP-43 due to nucleocytoplasmic transport defects caused by the C9orf72 repeat expansion can exacerbate these defects in a positive feedback loop, and (2) cytoplasmic accumulation of TDP-43 can directly trigger nucleocytoplasmic transport defects by disrupting the localization of Nups and TFs (Supplementary Fig. 16 ). A better understanding of the role of TDP-43 in intracellular transport pathways may help in developing therapeutic strategies for ALS/FTD and other TDP-43 proteinopathies.

Methods

Methods, including statements of data availability and any associated accession codes and references, are available at https://doi. org/10.1038/s41593-017-0047-3.

Articles

NATuRe NeuROScIeNce cultured in DMEM (Life Technologies) containing 10% FBS and 1% PenStrep (Sigma-Aldrich). Cells were transfected with either Lipofectamine 3000 (Life Technologies) or PolyMag Neo (Oz Biosciences) according to the manufacturer's protocol and the medium was changed the next day. Cells were fixed 48 h after transfection. Transfection efficiency was in the range of 70-80%. N2a cells were obtained from ATCC (CCL-131) and tested for mycoplasma contamination.

Collection of human fibroblasts was approved by the Emory and Mayo Clinic Institutional Review Boards, and informed consent for participation was obtained from every subject and/or an appropriate surrogate. Human fibroblasts from healthy control and ALS subjects were plated on coverslips coated with 0.5 mg/ ml poly-l-ornithine in DMEM containing 10% FBS supplemented with 0.5% PenStrep, 1% MEM with nonessential amino acids (NEAA) (Life Technologies) and 55 μ M 2-mercaptoethanol (Life Technologies).

Control and TDP-43 mutant iPSC lines were cultured and maintained in MTeSR medium (Stem Cell Technologies) in the presence of ROCK inhibitor. During the neuralization stage, cells were cultured for 2 d in WiCell Medium (DMEM/F12, knockout serum replacement, 1% l-glutamine, 1% NEAA, 110 μ M 2-mercaptoethanol) supplemented with 0.5 μ M LDN (Stemgent) and 10 μ M SB (Sigma) for BMP and SMAD pathway inhibition. To induce caudalization, cells were cultured for 5 d in 50% WiCell + 50% neural induction medium (NIM: DMEM/F12, 1% l-glutamine, 1% NEAA, 1% N2, 1% Pen/Strep and 2 μ g/ ml heparin) and supplemented with 0.5 μ M LDN, 10 μ M SB and 0.5 μ M retinoic acid (RA) (Sigma). For ventralization, cells were cultured and maintained in NIM supplemented with 0.5 μ M RA, 200 ng/ml SHH-C (Peprotech), 10 ng/ml BDNF (Invitrogen) and 0.4 μ g/ml ASAC (Sigma) for 7 d. At the stage of neural progenitor cell differentiation, cells were cultured for 6 d in 50% NIM + 50% neural differentiation medium (NDM: Neurobasal, 1% l-glutamine, 1% NEAA, 1% N2, 1% Pen/Strep) and supplemented with 0.5 μ M RA, 200 ng/ml SHH-C, 0.4 μ g/ ml ASAC, 2% B27, 10 ng/ml BDNF, 10 ng/ml GDNF (R&D Systems), 10 ng/ml IGF (R&D Systems) and 10 ng/ml CNTF (R&D Systems). The medium was then changed to 100% NDM. On differentiation day 32, iPSC neurons were treated with 20 mM AraC (Sigma) for 48 h to remove glial progenitors cells. Ninety percent of cells were positive for the Tuj-1 neuronal marker and 30-40% of the cells were positive for the motor neuron marker HB9, as previously described 56 . For coculture of human iPSC-derived neurons with mouse astrocytes, starting at DIV40, differentiated neurons were cocultured on top of a confluent monolayer of mouse cortical astrocytes prepared from postnatal day 0-1 mouse pups. The cells were kept until DIV 54-57, when they were fixed for mAb414 and lamin B staining.

Affinity pulldown of biotinylated proteins and immunoblotting. N2a cells were transfected with expression plasmids for GFP, myc-BirA*-TDP-43 or myc-BirA*-TDP-CTF using Lipofectamine 3000. The culture medium was changed after 4 h and, the next day, biotin was added to the medium at 50 μ M. After 24 h, cells were harvested and washed with cold PBS three times before cell lysis in urea buffer (8 M urea, 50 mM Tris-HCl pH 7.5) supplemented with protease inhibitor (Roche) and phosphatase inhibitor (Roche) for 20 min at room temperature (RT) with occasional vortexing. Cells were sonicated three times in 2-s pulses and centrifuged at 20,000 g at RT for 15 min. A small aliquot from the supernatant (input sample) was mixed with Laemmli buffer and boiled for 5 min. For the pulldown of biotinylated proteins, neutravidin beads (Thermo Fisher Scientific) were prewashed with lysis buffer and incubated with the remaining lysate sample with constant rotation overnight at RT. Beads were collected by centrifugation and washed five times with lysis buffer. Twenty percent of the sample was reserved for immunoblotting and 80% was used for mass spectrometry (Fig. 1b, d ).

Immunoblotting was performed according to standard protocols. Samples mixed with Laemmli buffer were heated for 5 min at 98 °C and spun down before running on a 10% SDS-PAGE gel and electrotransfer to a nitrocellulose membrane. The membrane was blocked with Odyssey blocking buffer (LiCor) for 1 h, followed by incubation with primary antibodies including anti-myc (1:2,000), anti-TDP-43 (1:2,000), anti-α -tubulin (1:10,000) and anti-γ -actin (1:10,000) overnight at 4 °C, and incubation with secondary antibodies (1:10,000, LI-COR) in blocking buffer in PBS with 0.1% Tween 20 for 1 h at RT. Biotinylated proteins were detected with IRDye streptavidin (1:10,000). Blots were scanned on an Odyssey imager (LiCor).

Sample digestion for mass spectrometry analysis. Neutravidin beads were spun down and residual urea was removed. Digestion buffer (200 μ L of 50 mM NH 4 HCO 3 ) was added and the bead solution was then treated with 1 mM dithiothreitol (DTT) at 25 °C for 30 min, followed by 5 mM iodoacetimide (IAA) at 25 °C for 30 min in the dark. Proteins were digested with 1 μ g of lysyl endopeptidase (Wako) at RT for 2 h and further digested overnight with 1:50 (w/w) trypsin (Promega) at RT. Resulting peptides were desalted with a Sep-Pak C18 column (Waters) and dried under vacuum.

LC-MS/MS analysis.

Liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) on an Orbitrap Fusion mass spectrometer (Thermo Fisher Scientific, San Jose, CA) was performed at the Emory Integrated Proteomics Core (EIPC) essentially as described 57 . The dried samples were resuspended in 10 μ L of loading

Methods

Constructs. The expression plasmids encoding nucleoporin (Nup) and nucleocytoplasmic transport factor (TF) fusion proteins were obtained from multiple sources (Supplementary Table 3 ). PCR-amplified human TDP-43 and TDP-CTF were cloned into the pcDNA3.1 myc-BioID vector (Addgene) 12 as XhoI/ KpnI fragments and cloned from GFP expression plasmids into the Kpn2I/MluI sites of the APEX2-Actin plasmid (Addgene) 20 . TDP-CTF (aa 208-414) was generated by PCR, and Q331K, M337V and NLS (KRK… .KVKR > AAA… .AVAA) 51 mutations were generated by site-directed mutagenesis (QuikChange II, Agilent) and cloned into pEGFP-C1 (Clontech) or mCherry vector. A flexible linker [(SGGG) 3 ] was inserted between all the fusion partners to facilitate correct protein folding. PCR primers used to generate PrLD and non-PrLD fragments of Nup98: 5′ -CAGATCTCCGGAGGCGGCTCCATGGAGATGTTTAACAAATCATTTGG-3′; 5′-ACAATTGCATCAACCTCCAGGCTGTGAGGCTTG-3′; 5′-CAGATCTCGATGCTTTTTGGGACAGCTACAAACACC-3′; 5′-ACAATTGATTCACTGTCCTTTTTTCTCTACCTGAGG-3′. PCR products were cloned into the BglII/MfeI sites of pEGFP-Nup98. PCR primers used to generate PrLD and non-PrLD fragments of Nup153: 5′-CGCTAGCTCTAGACTAGGGGACACCATGG-3′; 5′-GACCGGTGGTACAAAGGAGGATCCTGCAGAGCTAG-3′; 5′-C GCTAGCTCTAGACTAGGGGACACCATGTTTGGAACTGGAC CCTCAGCACC-3′; 5′-GACCGGTGGTTTCCTGCGTCTAACAGC-3′. PCR products were cloned into the NheI/AgeI sites of pNup153-EGFP. PCR primers used to generate PrLD and non-PrLD of Nup214: 5′-CAGATCTCCGGAGGCGGCGCGATGGGAGACGAGATGGATG-3′; 5′-ACAATTGCATCAGGCAGCTGCTGTGCTGGCTGTG-3′; 5′ -CAGATCTCCGGAGGCGGCGCGATGACACCACAGGTCAGCAGCTCAGG-3′ ; 5′-ACAATTGCCTCAGCTTCGCCAGCCACCAAAACCCTGG-3′. PCR products were cloned into pEGFP-Nup214 as BglII/MfeI fragments. GIPZ TDP-43 shRNA constructs (shTDP-43, V3LHS_636490) and a nonsilencing control (shCtrl, RHS4346) were obtained from Open Biosystems. Drosophila genetics. All Drosophila stocks and crosses were maintained on standard yeast/cornmeal/molasses food at 22 °C. GAL4 drivers (GMR GAL4 for retinal expression and D42 GAL4 for motor neuron expression) were used to express human TDP-43 with C-terminal YFP tag as previously described 52 . For controls, w 1118 flies were crossed with the appropriate GAL4 driver. Drosophila lines harboring mutations in nuclear pore components were obtained from the Bloomington Drosophila Stock Center and have the following genotypes: y Larval turning assays. Larval turning assays were performed as described 53 . Briefly, crosses were carried out at 22 °C and wandering third instar larvae were placed on a grape juice plate. After a short acclimation period, larvae were gently turned ventral side up. They were observed until they turned over (dorsal side up) and began making a forward motion. The time it took to complete this task was recorded.

For drug screening, UAS TDP-43 males were crossed with D42-GAL4 female virgins on fly food containing either DMSO, KPT-226 or KPT-335. For DMSO controls, the same volume of DMSO as the corresponding drug concentration was added. Crosses were made on drug food and maintained at 25 °C. Both female and male larvae were tested.

Cell culture and transfection. All procedures for animal experiments were approved by the Emory University Institutional Animal Care and Use Committee. Primary cortical neurons were isolated from cerebral cortex of mixed male and female C57BL/6 J mouse embryos at day 16.5 (E16.5) and cultured as previously described 54 . Briefly, cells were plated on coverslips coated with 0.5 mg/ml polyl-ornithine (Sigma-Aldrich) for 2 h in MEM (Life Technologies) containing 10% FBS (Hyclone). After switching to complete neural cell culture medium (Neurobasal medium (Life Technologies), 1% Glutamax (Life Technologies) and 2% B-27 supplements (Life Technologies)), cells were cultured for 5 d. Neurons were transected via magnetofection with 0.5 μ g plasmid DNA and 1.75 μ L NeuroMag (Oz Biosciences) as described 55 . Cells were cultured for 24 h and processed for immunofluorescence. For TDP-43 knockdown, cells were transfected with expression plasmids for shCtrl or shTDP-43 and cultured for another 5 d to efficiently reduce TDP-43 protein levels 9 . Transfection efficiency was in the range of 20-30% for overexpression and 10-15% for TDP-43 knockdown experiments. shTDP-43 reduced TDP-43 protein levels to 61% of those in shCtrl-transfected cells.

Mouse Neuro-2a (N2a) neuroblastoma cells were plated in 6-well plates for immunoblotting or on coverslips in 12-well plates for immunofluorescence and

NATuRe NeuROScIeNce

anti-Nesprin-2 (1:100), anti-Ran (1:500), anti-RanGAP1 (1:300) and anti-γ H2AX (1:500) overnight at 4 °C, followed by incubation with fluorophore-conjugated secondary antibodies and streptavidin for 1 h at RT. F-actin was labeled with Alexa Fluor 488 or rhodamine-conjugated phalloidin (1:1,000) for 1 h at RT.

To examine DNA damage, cortical neurons were transfected with expression plasmids for GFP or GFP-tagged TDP-CTF, TDP-43 WT or TDP-43 Q331K . γ H2AX has been identified as the marker of DNA double-strand breaks 59 . The mean pixel intensity of stained γ H2AX in the nucleus of human fibroblasts and transfected cortical neurons was analyzed by ImageJ software (National Institutes of Health). DNA-damage-inducing calicheamicin γ 1 was added at 5 nM for 2 h as a positive control.

To quantitate the percentage of cells that have morphological abnormalities in the NM stained with anti-lamin B or anti-RanGAP1 antibodies, the presence of irregularity, distortion or rifts in the NM was scored. For 3D reconstructions of whole nuclei, lamin B staining was used to outline the nuclear region of cortical neurons. On average 45 to 50 z-stack sections at 0.3 µ m steps were required to reconstruct the whole nucleus using Imaris software (Bitplane). A surface was created to mask the nucleus with a smoothing factor of 0.3 µ m. Optical sections in the xy, xz and yz planes were generated.

To investigate the nucleocytoplasmic transport of proteins, NES-tdTomato-NLS, a protein transport reporter 60 , was transfected into human fibroblasts or cotransfected with expression plasmids for GFP or GFP-tagged TDP-CTF, TDP-43 WT , TDP-43 Q331K , TDP-43 M337V or TDP-43 mtNLS into cortical neurons. The mean pixel intensity of NES-tdTomato-NLS and GFP-TDP-43 in the nucleus and cytoplasm were measured for calculating the nuclear-to-cytoplasmic (N-to-C) ratio. To examine whether induction of apoptosis causes a similar defect in the nucleocytoplasmic transport of proteins, the GFP-transfected cells were incubated with staurosporine at 50 nM or 250 nM for 12 h to induce caspase-3/9-dependent apoptosis 61 . The inhibition of nuclear protein import was induced by importazole 62 at 2.5 μ M or 5 μ M for 12 h. DMSO was added as the vehicle control.

For high-resolution imaging, z-series (15-50 sections, 0.15-0.3 µ m steps) were acquired according to the different experimental designs with an epifluorescence microscope (Ti, Nikon) equipped with a cooled CCD camera (HQ2, Photometrics). Within each experiment, all groups were imaged with the same acquisition settings. Image stacks were deconvolved using a 3D blind constrained iterative algorithm (AutoQuant, Media Cybernetics).

For visualization of NPCs, super-resolution 3D structured illumination microscopy (SIM) was performed on a Nikon microscope using a 100× (1.49 NA) objective. Ten to 30 z-stacks were acquired per image to capture the entire nuclear volume and SIM reconstructions were performed in NIS elements (Nikon). Fourier transformations were applied to assess reconstruction quality. 3D SIM images were analyzed in ImageJ. Series of widefield images were acquired and merged with the super-resolution image of Nup98 and mAb414 staining.

For imaging iPSC-derived neurons, images were taken on a LSM800 confocal microscope using Airyscan mode super-resolution. All images represent z optical slices of the nuclear membrane. Eighty to 90 cells were analyzed per group per staining.

Fluorescence in situ hybridization (FISH) and immunofluorescence. Cortical neurons and human fibroblasts were washed with PBS and fixed with 4% PFA in PBS for 10 min. FISH was performed with some modifications of a previously described method 63 . Briefly, fixed cells were permeabilized with 50%, 70% and 100% ethanol in successive steps, stored at -20 °C for overnight and rehydrated the next day with 1× SSC for 10 min. Cells were washed with 10% formamide (Sigma-Aldrich) for 5 min and incubated in hybridization buffer (20% dextran sulfate, 4× SSC, 4 mg/mL BSA, 20 mM ribonucleoside vanadyl complex and 10 mM sodium phosphate buffer, pH 7.0) at 37 °C for 1.5 h. To detect poly(A) RNAs, 1 μ L of 25 µ M biotinylated oligo(dT) probes (Biosearch Technologies) were resuspended with 10 μ g each of E. coli tRNA and salmon sperm DNA in 50 μ L of hybridization buffer and incubated on the coverslips at 37 °C overnight. Oligo(dA) probes were used as a negative control. Cells were washed with PBS for 10 min to remove formamide, blocked with 5% BSA for 45 min and incubated with Cy3conjugated streptavidin for 1 h at RT to detect the biotinylated oligo(dT) probes. Mean pixel intensities for poly(A) RNA in the nucleus and cytoplasm of cells were determined with ImageJ software.

Metabolic labeling of newly synthesized proteins. Cortical neurons were transfected with expression vectors for GFP or GFP-tagged TDP-43 WT or TDP-CTF. After 24 h, cells were incubated in methionine-free DMEM (Thermo Fisher Scientific) with or without 40 µ M anisomycin (Sigma-Aldrich) for 1 h at 37°, followed by incubation with 100 µ g/mL l-azidohomoalanine (AHA) (Thermo Fisher Scientific) for 5 min. Cells were washed with PBS and fixed by 4% PFA, permeabilized with 0.2% Triton X-100 for 5 min and blocked with 3% BSA in PBS for 30 min. Click-iT reaction cocktail (50 μ L per sample) was prepared immediately before the end of blocking using Click-iT assay kits and Alexa Fluor 647-conjugated alkyne (Thermo Fisher Scientific). Samples were incubated for 30 min at RT and washed with 3% BSA in PBS before mounting. The mean pixel intensity of AHA in the cell body was quantified with ImageJ software. buffer (0.1% formic acid, 0.03% trifluoroacetic acid, 1% acetonitrile), vortexed for 5 min and centrifuged at maximum speed (20,000g) for 2 min. Peptide mixtures (2 µ L) were loaded onto a 25 cm × 75 µ m internal diameter fused silica column (New Objective, Woburn, MA) self-packed with 1.9 µ m C18 resin (Dr. Maisch, Germany). Separation was carried out over a 120 min gradient by a Dionex Ultimate 3000 RSLCnano at a flow rate of 350 nL/min. The gradient ranged from 3% to 80% buffer B (buffer A: 0.1% formic acid in water, buffer B: 0.1% formic in ACN). The mass spectrometer cycle was programmed to collect at the top speed for 3-s cycles. The MS scans (400-1,600 m/z range, 200,000 AGC, 50 ms maximum ion time) were collected at a resolution of 120,000 at m/z 200 in profile mode and higherenergy collisional dissociation (HCD) MS/MS spectra (0.7 m/z isolation width, 30% collision energy, 10,000 AGC target, 35 ms maximum ion time) were detected in the ion trap. Dynamic exclusion was set to exclude previous sequenced precursor ions for 20 s within a 10-ppm window. Precursor ions with + 1 and + 8 or higher charge states were excluded from sequencing.

Database search. All raw data files were processed using the Proteome Discoverer 2.0 data analysis suite (Thermo Scientific, San Jose, CA). The database was downloaded from Uniprot (15 April 2015) and consists of 53,291 mouse target sequences supplemented with 2 BirA*-fusion sequences. Peptide matches were restricted to full tryptic cleavage, a precursor mass tolerance of ± 10 ppm and a fragment mass tolerance of 0.6 Da. Dynamic modifications were set for methionine oxidation (+ 15.99492 Da), asparagine and glutamine deamidation (+ 0.98402 Da), lysine ubiquitination (+ 114.04293 Da), biotinylation (+ 226.2994 Da) on the N terminus and lysine and protein N-terminal acetylation (+ 42.03670). A maximum of three modifications were allowed per peptide (up to two missed cleavages) and a static modification of + 57.021465 Da was set for carbamidomethyl cysteine. The Percolator 58 node in Proteome Discoverer was used to filter the peptide spectral match (PSM) false discovery rate to 1%. To filter the results, in comparisons 1 and 2, a protein was identified as TDP-43 or TDP-CTF associated if there was no missing data, the average number of PSMs in the TDP-43 or TDP-CTF associated proteome was ≥ 10 and Mock ≤ 2. In comparisons 3 and 4, the same criteria were also applied to a protein considering a TDP-43-preferred interactor when the PSM in BirA*-TDP-43 was ≥ 10 and Mock ≤ 2, and the fold increase was ≥ 2 0.5 as compared to the PSM in BirA*-TDP-CTF, and vice versa. Mock control cells provided the background levels of endogenous biotinylation and nonspecific pulldown. The identification of BirA*-TDP-43-or BirA*-TDP-CTF-preferred interactors addresses their cellular compartment-and function-specific roles. These proteins were analyzed and categorized on the basis of biological process, cellular component and molecular function using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) Bioinformatic Resources 6.8 (https://david.ncifcrf.gov/). Bioinformatics analyses. Prion-like amino acid composition of human Nups and TFs was predicted by the open-source PLAAC algorithm (http://plaac.wi.mit. edu/). The log-likelihood ratio (LLR) score allows the exploratory screening of potential PrLDs. Since low content of hydrophobic residues and high net charge are known predictors for low-complexity sequence domains and intrinsically disordered proteins, we performed a predictive analysis of mean hydrophobicity using ProtScale (https://web.expasy.org/protscale/) with the hydrophobicity scale of Kyte and Doolittle. Hydrophobic amino acids include alanine (1.8), cysteine (2.5), glycine (-0.4), isoleucine (4.5), leucine (3.8), methionine (1.9), phenylalanine (2.8) and valine (4.2), and hydrophilic residues include arginine (-4.5), asparagine (-3.5), aspartate (-3.5), histidine (-3.2), lysine (-3.9), proline (-1.6), glutamine (-3.5), glutamate (-3.5) and tyrosine (-1.3). Low-complexity and intrinsic disorder predictions were performed using DisEMBL version 1.5 (http://dis.embl.de/) and GlobPlot version 2.3 (http://globplot.embl.de/) to validate the relationship between hydrophobicity and protein intrinsic disorder in human Nups and TFs.

Identification of the TDP

Immunofluorescence and image acquisition and analysis. To validate the interaction of Nups and TFs with TDP-CTF, N2a cells were cotransfected with expression plasmids for GFP or epitope-tagged Nups or TFs (Supplementary Table 3 ) and mCherry or mCherry-tagged TDP-CTF. Cells were fixed with 4% paraformaldehyde (PFA) in PBS 48 h after transfection for 15 min at RT, permeabilized with 0.2% Triton X-100 in PBS for 5 min and blocked with 5% bovine serum albumin (BSA) for 45 min. Cells were incubated with primary antibodies including anti-myc (1:200), anti-Flag (1:500), anti-HA (1:500), anti-T7 (1:500), anti-TDP-43 (1:500), anti-pTDP-43 (Ser409/Ser410) (1:500), anti-SQSTM1/p62 (1:1,000), anti-nuclear pore complex proteins (mAb414; 1:1,000), anti-Nup98 (1:500), anti-Nup205 (1:100), anti-Lamin B (1:200), anti-Sun2 (1:100), Electron microscopy of the nuclear envelope. To visualize nuclear envelope morphology in transfected N2a cells by electron microscopy, we used fusion constructs of the engineered APEX2 peroxidase with Flag-tagged TDP-43 and TDP-CTF 20 . N2a cells were transfected with expression plasmids for Flag-APEX2-TDP-43, Flag-APEX2-TDP-CTF or GFP-TDP-CTF. Cells were fixed with PFA and 2.5% glutaraldehyde in 0.1 M phosphate buffer. APEX2 catalyzes the deposition of 3,3′ -diaminobenzoic acid (DAB), which allowed us to identify APEX2-TDP-43-and APEX2-TDP-CTF-expressing cells under electron microscopy (JEOL JEM-1400).

Immunohistochemistry. All procedures for collection of human brain tissue were approved by the Emory University and Mayo Clinic Institutional Review Board. Informed consent was obtained from all patients or their authorized legal representatives. Paraffin-embedded sections from post-mortem human motor and frontal cortex, hippocampus and cerebellum at 8 μ m thickness were deparaffinized by incubation in a 60 °C oven for 30 min and rehydrated by immersion in Histo-Clear and 100% ethanol and 95% ethanol solutions. Antigen retrieval was then performed by microwaving sections in 10 mM citrate buffer, pH 6.0, for a total of 5 min and allowing them to cool to RT for 30 min. Peroxidase quenching was performed by incubating sections in a 3% hydrogen peroxide solution in methanol for 5 min at 40 °C and then rinsing in Tris-Brij buffer (1 M Tris-Cl pH 7.5, 100 mM NaCl, 5 mM MgCl 2 , 0.125% Brij 35). For blocking, sections were incubated in normal goat serum (Elite Vectastain ABC kit) for 15 min at 40 °C. Sections were then incubated with Nup205 (1:50), lamin B1 (1:300) or RanGAP1 (1:50) antibodies (diluted in 1% BSA in Tris-Brij 7.5) overnight at 4 °C. The following day sections were incubated in biotinylated secondary antibody at 5 μ L/mL (Elite IgG Vectastain ABC kit) for 30 min at 37 °C and then incubated with the avidin-biotin enzyme complex (Vector Laboratories) for 30 min. Stains were visualized by incubation of DAB chromogen (Sigma-Aldrich) for 5 min at RT. Slides were then dehydrated in an ethanol series and mounted on cover slips. Investigators were blinded for quantitative analysis of IHC staining.

Statistical analysis.

Statistical analysis was performed with unpaired t-test, oneway ANOVA or two-way ANOVA based on the experimental design. Bonferroni's post hoc test was used. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in the previous literatures in the field 33,39,64 . Data distribution was assumed to be normal, but this was not formally tested. Data collection and analysis were not performed blind to the conditions of the experiments, except for quantitative analysis of human fibroblasts and IHC staining. In this study, no animals or samples were assigned to experimental groups, and therefore no randomization was performed. Data from different experiments were analyzed using GraphPad Prism Software. Differences were considered statistically significant for P values < 0.05.

Life Sciences Reporting Summary. Further information on experimental design is available in the Life Sciences Reporting Summary. Life Sciences Reporting Summary Nature Research wishes to improve the reproducibility of the work that we publish. This form is intended for publication with all accepted life science papers and provides structure for consistency and transparency in reporting. Every life science submission will use this form; some list items might not apply to an individual manuscript, but all fields must be completed for clarity.

For further information on the points included in this form, see Reporting Life Sciences Research. For further information on Nature Research policies, including our data availability policy, see Authors & Referees and the Editorial Checklist.

Experimental design 1. Sample size

Describe how sample size was determined.

No statistic analysis was used to predetermine sample size. Sample sizes were chosen to be similar or exceed those reported in the previous literatures in the field. Each experiment was repeated 3-6 times, and the statistical analysis demonstrates that our sample sizes revealed significant differences between groups.

2.Data exclusions

Describe any data exclusions.

No data were excluded from the analyses in all the in vitro studies. For in vivo experiments in Drososophila, outliers were identified with GraphPad Prism, using the ROUT method.

3.Replication

Describe whether the experimental findings were reliably reproduced.

The findings in this study were collected from multiple independent experiments, and were reliably reproduced.

4.Randomization

Describe how samples/organisms/participants were allocated into experimental groups.

No randomization was done in this study, since no samples/organisms/participants were allocated into experimental groups.

5.Blinding

Describe whether the investigators were blinded to group allocation during data collection and/or analysis.

Investigators were blinded for quantitative analysis of human fibroblasts and IHC staining. For studies with transfected cell lines, blinding was not possible due to obvious staining patterns observed in microscopy.

Note: all studies involving animals and/or human research participants must disclose whether blinding and randomization were used.

availability

Data availability. Data available on reasonable request from the authors. Proteomic source data are available from Synapse (http://www.synapse.org) via accession syn11597066. Figure 2 and Supplementary Figs. 2 and 3 are associated with the source data.

Competing interests

The authors declare that they have no competing financial interests.

NATuRe NeuROScIeNce

nature research | life sciences reporting summary June 2017

6.Statistical parameters

For all figures and tables that use statistical methods, confirm that the following items are present in relevant figure legends (or in the Methods section if additional space is needed).

n/a Confirmed

The exact sample size (n) for each experimental group/condition, given as a discrete number and unit of measurement (animals, litters, cultures, etc.) A description of how samples were collected, noting whether measurements were taken from distinct samples or whether the same sample was measured repeatedly A statement indicating how many times each experiment was replicated

The statistical test(s) used and whether they are one-or two-sided (note: only common tests should be described solely by name; more complex techniques should be described in the Methods section) A description of any assumptions or corrections, such as an adjustment for multiple comparisons

The test results (e.g. P values) given as exact values whenever possible and with confidence intervals noted A clear description of statistics including central tendency (e.g. median, mean) and variation (e.g. standard deviation, interquartile range)

Clearly defined error bars

See the web collection on statistics for biologists for further resources and guidance.

Software

Policy information about availability of computer code

Describe the software used to analyze the data in this study.

No custom algorithms or software were used. Graphpad Prism 5.0 was used for statistical analysis. Prion-like amino acid composition of human Nups and TFs was predicted by the PLAAC algorithm (http://plaac.wi.mit.edu/). For predictive analysis of mean hydrophobicity, ProtScale was used with the hydrophobicity scale of Kyte and Doolittle (http://web.expasy.org/protscale/). Low-complexity and intrinsic disorder predictions were performed using DisEMBL 1.5 (http://dis.embl.de/) and GlobPlot 2.3 (http://globplot.embl.de/). Proteins were analyzed and categorized on the basis of biological process, cellular component and molecular function using the Database for Annotation, Visualization, and Integrated Discovery 6.8 (DAVID) (https://david.ncifcrf.gov/). For high-resolution imaging, Z-stacks were acquired with NIS elements (Nikon). Image stacks were deconvolved using a 3D blind constrained iterative algorithm (AutoQuant, Media Cybernetics). For superresolution 3D structured illumination microscopy, SIM reconstructions were performed in NIS elements (Nikon). 3D SIM images were analyzed in ImageJ v1.48 (https://imagej.nih.gov/ij/). Western blots were scanned with Image Studio Lite 4.0 (https://www.licor.com/bio/products/software/image\_studio\_lite/). Network analysis of the TDP-CTF versus TDP-43 proteome in the nucleocytoplasmic transport pathway were performed with Cytoscape v3.5 (http:// www.cytoscape.org/), using the GeneMANIA (http://apps.cytoscape.org/apps/ genemania) and ClueGo (http://apps.cytoscape.org/apps/cluego) plugins.

For manuscripts utilizing custom algorithms or software that are central to the paper but not yet described in the published literature, software must be made available to editors and reviewers upon request. We strongly encourage code deposition in a community repository (e.g. GitHub). Nature Methods guidance for providing algorithms and software for publication provides further information on this topic.

Materials and reagents

Policy information about availability of materials

9.Antibodies

Describe the antibodies used and how they were validated for use in the system under study (i.e. assay and species).

Validated antibodies were used as also listed in Supplementary Table b. Describe the method of cell line authentication used. N2a cells were confirmed as murine cells of neuronal origin (proteomics and ICC).

c. Report whether the cell lines were tested for mycoplasma contamination.

All cell lines tested negative for mycoplasma contamination. Timed pregnant C57BL/6 mice (Charles River) were sacrificed, and embryos were collected at embryonic day 16.5 (E16.5). Primary neurons were isolated from both male and female embryos and pooled. In experiments with Drosophila, female and male adults and larvae were used.

Policy information about studies involving human research participants

Acknowledgements

AcknowledgementsWe thank K. R. Moss and K. T. Thomas for help with the preparation of primary cortical neurons, G. J. Bassell for logistical support and M. Castanedes-Casey for expert staining of human brain tissue.For numerous expression plasmids used in this study (Supplementary Table 3), we thank M. Hetzer (The Salk Institute for Biological Studies), J. Ellenberg (EMBL Heidelberg), V. Doye (Institut Jacques Monod, Université Paris Diderot/CNRS), J. Teodoro (McGill University) and J.Joseph (National Centre for Cell Science, S.P. Pune University), L. Gerace (The Scripps Research Institute), B. Paschal (University of Virginia School of Medicine) and M. Dasso (Eunice Kennedy Shriver National Institute of Child Health and Human Development).We thank the Bloomington Drosophila Stock Center for fly lines and Emory Integrated Proteomics Core, Neuropathology/ Histochemistry Core and Robert P. Apkarian Integrated Electron Microscopy Core for technical support.This work was supported by grants from the ALS Association (17-IIP-353) to W.R. and (16-IIP-278) to R.S.; the Emory Medicine Catalyst Funding Program to W.R.; Muscular Dystrophy Association (MDA348086) to R.S.; NIH grants K08-NS087121 to C.M.H., P30-NS055077 to the Neuropathology/Histochemistry core of the Emory NINDS Neurosciences Core Facility, AG025688 to Emory's Alzheimer's Disease Research Center, NIH R01-NS091299 to D.C.Z., R35-NS097261 to R.R., R01-NS085207 to R.S., R01NS091749 to W.R. and R01-NS093362 to W.R. and T.K., who is also supported by The Bluefield Project to Cure FTD; the Alzheimer's Drug Discovery Foundation to N.J.C; and NIH R01-AG053960 to N.T.S., who is also supported in part by the Alzheimer's Association (ALZ), Alzheimer's Research UK (ARUK), The Michael J. Fox Foundation for Parkinson's Research (MJFF) and a Weston Brain Institute Biomarkers Across Neurodegenerative Diseases Grant (11060).S.V. was partially funded by UBRP with funds from the UA Provost's Office.P.G.D.-A. was funded by an ARCS Fellowship Roche Foundation Award.

Failed to load PDF:

StripeM-Inner

Paper sources

Abstract screening pilot

Abstract screening results

Extraction pilot

Extraction results

Research report


Modify setup